View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_38 (Length: 266)
Name: NF1259_low_38
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 31 - 221
Target Start/End: Original strand, 975238 - 975433
Alignment:
| Q |
31 |
atcgaccagataaccagaggaaaaaaccacagtcaaatcatagatgatgtcagatt------caacgtctgattcggttttcaaaacattaaatttgaat |
124 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||| ||||||| || |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
975238 |
atcgaccagataaccagaggaagaaaccacagttaaatcatagataatgtcagtttatggttcaacgtctgatttggttttcaaa-cattaaatttgaat |
975336 |
T |
|
| Q |
125 |
taatataatgttacaaacctctttagttttttcttgaatgtcgatgattttgtcatcccaattgcttaattgagcactcataaactcatcaagttta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
975337 |
taatataatgttacaaacctctttagttttttcttgaatgtcgatgattttgtcatcccaattgcttaattgagcactcataaactcatcaagttta |
975433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 5590649 - 5590768
Alignment:
| Q |
102 |
ttttcaaaacattaaatttgaattaatataatgttacaaacctctttagttttttcttgaatgtcgatgattttgtcatcccaattgcttaattgagcac |
201 |
Q |
| |
|
||||||||||||| ||| |||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5590649 |
ttttcaaaacattgaatatgaacaaatataatgttacaaacctctttagttttctcttgaatgttgatgattttgtcatcccaattgcttaattgagcac |
5590748 |
T |
|
| Q |
202 |
tcataaactcatcaagttta |
221 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
5590749 |
tcataaactcatcaacttta |
5590768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 133 - 221
Target Start/End: Original strand, 5066485 - 5066573
Alignment:
| Q |
133 |
tgttacaaacctctttagttttttcttgaatgtcgatgattttgtcatcccaattgcttaattgagcactcataaactcatcaagttta |
221 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||| |||||||| |||| |||| ||||| |||||||||| |||| |
|
|
| T |
5066485 |
tgttacaaacctctttagttttgtcttgaatgttgatgattttgttatcccaatcacttacatgagttctcatgaactcatcaatttta |
5066573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University