View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1259_low_47 (Length: 223)

Name: NF1259_low_47
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1259_low_47
NF1259_low_47
[»] chr4 (2 HSPs)
chr4 (57-142)||(30519177-30519262)
chr4 (1-33)||(30519283-30519315)
[»] chr2 (1 HSPs)
chr2 (63-137)||(38897076-38897153)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 57 - 142
Target Start/End: Complemental strand, 30519262 - 30519177
Alignment:
Q  57 agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcatacacctatgct 142  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  30519262 agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcatacacctttgct 30519177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 30519315 - 30519283
Alignment:
Q  1 aatatagaaaaggttattggatgaaataggatt 33  Q
    |||||||||||||||||||||||||||||||||    
T  30519315 aatatagaaaaggttattggatgaaataggatt 30519283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 63 - 137
Target Start/End: Complemental strand, 38897153 - 38897076
Alignment:
Q  63 aacaaattatgggataatcattccaaatggagatcaactttcttcc----aacctcatcatatgtgtcatcatacacct 137  Q
    ||||||||||| |||||||||||||||||||   |||||||||| |    |||||||||||||||||||||||||||||    
T  38897153 aacaaattatgagataatcattccaaatggatg-caactttcttgctatcaacctcatcatatgtgtcatcatacacct 38897076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University