View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12600_high_24 (Length: 228)
Name: NF12600_high_24
Description: NF12600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12600_high_24 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 108 - 228
Target Start/End: Complemental strand, 6401111 - 6400991
Alignment:
| Q |
108 |
aaatcacccgaagtttgatagctgatagttatgtaggtttatttctctgtgaaatttgtaacttttttccttttgtcataacagaatatgtcgattgtat |
207 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6401111 |
aaattacccgaagtttgataactgatagttatgtaggtttatttctctgtgaaatttgtaacttttttccttttgtcataacagaatatgtcgattgtat |
6401012 |
T |
|
| Q |
208 |
atccatatacaacttctcttt |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6401011 |
atccatatacaacttctcttt |
6400991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University