View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12600_low_38 (Length: 266)
Name: NF12600_low_38
Description: NF12600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12600_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 2 - 253
Target Start/End: Complemental strand, 6473670 - 6473419
Alignment:
| Q |
2 |
catctcagaaacttttgcttattaaaatctatcagacaggagatgccgctttgatgatgtgagcatattagcttgaattatttgtctacatgcctattat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6473670 |
catctcagaaacttttgcttattaaaatctatcagacaggagatgccgctttgatgatgtgagcatattagcttgaattatttgtctacatgcctattat |
6473571 |
T |
 |
| Q |
102 |
gcttctattagctgctctttgtaagtataagagactcctcgatcaccatcgactacctgtccattccccctcaatatcctgcattatattatatccaaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6473570 |
gcttctattagctgctctttgtaagtataagagactcctcgatcaccatcgactacctgtccattccccctcaatatcctgcattatattatatccaaaa |
6473471 |
T |
 |
| Q |
202 |
atctaaaaatgagccgagaaatgatcttgttatagactagaatgcatgatct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6473470 |
atctaaaaatgagccgagaaatgatcttgttatagactagaatgcatgatct |
6473419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University