View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12600_low_39 (Length: 257)
Name: NF12600_low_39
Description: NF12600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12600_low_39 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 257
Target Start/End: Original strand, 23176526 - 23176772
Alignment:
| Q |
12 |
agcataggcttggctgacactaaattgccccggttttgatttggcacacgaaaaatgttgcaacagcttcgtagatgattctaatttgcttctggcttcg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23176526 |
agcataggcttggctgacactaaattgccccggttttgatttggcgcacgaaaaatgttgcaacagcttcgtagatgattctaatttgcttctggcttcg |
23176625 |
T |
 |
| Q |
112 |
aagcacacaaaattcctgtagtgtttctaggagcaatggattaaggtgccgcctcatgttttgctcattgcttaatgtacttctgttgttctcccatgat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23176626 |
aagcacacaaaattcctgtagtgtttctaggagcaatggattaaggtgccacctcatgttttgctcattgcttaatgtacttctgttgttctcccatgat |
23176725 |
T |
 |
| Q |
212 |
ataataa-cctcttgcaacggccatacgcccttgcttcagtgcttga |
257 |
Q |
| |
|
|||| || |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
23176726 |
ataacaaccctcttgcaacgaccatacgcccttgcttccgtgcttga |
23176772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University