View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12600_low_44 (Length: 241)
Name: NF12600_low_44
Description: NF12600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12600_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 11197028 - 11196792
Alignment:
| Q |
1 |
tgtttgaaaagttgaagtagcagtaacagaagcagaaacagtactagtacttccactagaaccaccttgtgaagtagtagctgaaactgaagatgaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11197028 |
tgtttgaaaagttgaagtagcagtaacagaagcagaaacagtactagtacttccactagaaccaccttgtgaagtagtagctgaaactgaagatgaagat |
11196929 |
T |
 |
| Q |
101 |
tgtgaacnnnnnnnnnnnnnnnnnnnttccacaggctttcttgaacggtaacgacgtcgaatcatatggcggtcacagtacttagaatcaggatgagcat |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11196928 |
tgtgaacaagaagaagaagaagaagattccacaggctttcttgaacggtaacgacgtcgaatcatatgccggtcacagtacttagaatcaggatgagcat |
11196829 |
T |
 |
| Q |
201 |
ccctagcacatctccattttttaccatctgtgcttct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11196828 |
ccctagcacatctccattttttaccatctgttcttct |
11196792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University