View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12600_low_47 (Length: 228)

Name: NF12600_low_47
Description: NF12600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12600_low_47
NF12600_low_47
[»] chr5 (1 HSPs)
chr5 (108-228)||(6400991-6401111)


Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 108 - 228
Target Start/End: Complemental strand, 6401111 - 6400991
Alignment:
108 aaatcacccgaagtttgatagctgatagttatgtaggtttatttctctgtgaaatttgtaacttttttccttttgtcataacagaatatgtcgattgtat 207  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6401111 aaattacccgaagtttgataactgatagttatgtaggtttatttctctgtgaaatttgtaacttttttccttttgtcataacagaatatgtcgattgtat 6401012  T
208 atccatatacaacttctcttt 228  Q
    |||||||||||||||||||||    
6401011 atccatatacaacttctcttt 6400991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University