View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12601_high_18 (Length: 217)

Name: NF12601_high_18
Description: NF12601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12601_high_18
NF12601_high_18
[»] chr5 (2 HSPs)
chr5 (6-110)||(222732-222836)
chr5 (142-217)||(222630-222705)


Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 6 - 110
Target Start/End: Complemental strand, 222836 - 222732
Alignment:
6 agcagcagagaacaactaccaccaccaaccagaaaaccttaggcgttgcctgggggaagaactcttctaattccacgaaatcccctttctcggatgttgc 105  Q
    ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||    
222836 agcagcagaaaacaactaccaccaccaaccagaaaaccttaggcgtcgcctgggggaagaactcttctaattccacaaaatcccctttctccgatgttgc 222737  T
106 caggt 110  Q
    |||||    
222736 caggt 222732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 142 - 217
Target Start/End: Complemental strand, 222705 - 222630
Alignment:
142 ccttctcaatttctcagtatttaattgaaaaatgtcactattacagttacatgactgagaagaatcgaaaactaca 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
222705 ccttctcaatttctcagtatttaattgaaaaatgtcactattacagttacatgactgagaagaatcgaaaactaca 222630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University