View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12601_low_13 (Length: 277)
Name: NF12601_low_13
Description: NF12601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12601_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 268
Target Start/End: Original strand, 6830660 - 6830917
Alignment:
| Q |
18 |
acatggtgaattccatggcaaggtgtaaggagattcggtatgtgaggtcaaatcctgagtgaggtattaataggctgatttaataggagaagtttctatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| | ||||||| |||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
6830660 |
acatggtgaattccatggcaaggtgtaaagagattcgatatgtgaagccaaatcccgagtgaggtattgataggctgatttaataggagaagtttccatc |
6830759 |
T |
|
| Q |
118 |
ac-------tagtcatggccaagcacggacggtcctcaaaaccatgcgagggggctttatactagccattttttaacaaatactctaggagaagttaatt |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6830760 |
actactcactagtcatggccaagcacggacggtcctcaaaaccatgcgagggggctttatactagccattttttaacaaatactctaggagaagttgatt |
6830859 |
T |
|
| Q |
211 |
tatcctgttccaattcaactcagaaccgttagtataggagaaaacaatgtattcatct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6830860 |
tatcctgttccaattcaactcagaaccgttagtataggagaaaacaatgtattcatct |
6830917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University