View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12601_low_23 (Length: 231)
Name: NF12601_low_23
Description: NF12601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12601_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 11 - 216
Target Start/End: Complemental strand, 40575733 - 40575528
Alignment:
| Q |
11 |
agagagaagaatgctgatttgatctgcttcaccctgcagtatcannnnnnnnaaatatataagtcagtctacccttctacttagcaattttcattgcttc |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40575733 |
agagagtagaatgctgatttgatctgcttcaccctgcagtatcattttttttaaatatataagtcagtctacccttctacttagcaattttcgttgcttc |
40575634 |
T |
 |
| Q |
111 |
catgaatgggtgagtacaggaaattcaaaaaacaaggaagctagacagtttatccataaataaaacagaatttgaatgatctaatagttggaaccatgct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40575633 |
catgaatgggtgagtacaggaaattcaaaaaacaaggaagctagacagtttatccataaataaaacagaatttgaatgatctaatagttggaaccatgct |
40575534 |
T |
 |
| Q |
211 |
caaaat |
216 |
Q |
| |
|
|||||| |
|
|
| T |
40575533 |
caaaat |
40575528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University