View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12601_low_26 (Length: 218)
Name: NF12601_low_26
Description: NF12601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12601_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 34594788 - 34594927
Alignment:
| Q |
1 |
tacggttgattcttccatgggctttgtatgttctgcgtctttgcttctgtgcttgattgacttggatatgtgaaacatatagagcatcaacatccaaacc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34594788 |
tacggttgattcttccatgggctctgtatgttctgcgtctttgcttctgtgcttgattgacttggatatgtgaaacatatagagcatcaacatccaaacc |
34594887 |
T |
|
| Q |
101 |
tttgacctagaaagtagtaattaacattcaaatgagcatt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34594888 |
tttgacctagaaagtagtaattaacattcaaatgagcatt |
34594927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 217
Target Start/End: Original strand, 34594974 - 34595005
Alignment:
| Q |
186 |
gattcagaacttacttcagcattactctctgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34594974 |
gattcagaacttacttcagcattactctctgc |
34595005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 38632170 - 38632059
Alignment:
| Q |
1 |
tacggttgattcttccatgggctttgtatgttctgcgtctttgcttctgtgcttgattgacttggatatgtgaaacatatagagcatcaacatccaaacc |
100 |
Q |
| |
|
|||| |||||||||||||| || |||| || | | ||||||||| || ||||||||||| |||| ||| || || || |||||||| ||||||||||| |
|
|
| T |
38632170 |
tacgattgattcttccatgagccctgtaggtacgtcttctttgcttttgagcttgattgacctggacatgggacacgtagagagcatccacatccaaacc |
38632071 |
T |
|
| Q |
101 |
tttgacctagaa |
112 |
Q |
| |
|
||| |||||||| |
|
|
| T |
38632070 |
tttcacctagaa |
38632059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University