View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12601_low_27 (Length: 217)
Name: NF12601_low_27
Description: NF12601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12601_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 6 - 110
Target Start/End: Complemental strand, 222836 - 222732
Alignment:
| Q |
6 |
agcagcagagaacaactaccaccaccaaccagaaaaccttaggcgttgcctgggggaagaactcttctaattccacgaaatcccctttctcggatgttgc |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
222836 |
agcagcagaaaacaactaccaccaccaaccagaaaaccttaggcgtcgcctgggggaagaactcttctaattccacaaaatcccctttctccgatgttgc |
222737 |
T |
 |
| Q |
106 |
caggt |
110 |
Q |
| |
|
||||| |
|
|
| T |
222736 |
caggt |
222732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 142 - 217
Target Start/End: Complemental strand, 222705 - 222630
Alignment:
| Q |
142 |
ccttctcaatttctcagtatttaattgaaaaatgtcactattacagttacatgactgagaagaatcgaaaactaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222705 |
ccttctcaatttctcagtatttaattgaaaaatgtcactattacagttacatgactgagaagaatcgaaaactaca |
222630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University