View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12601_low_29 (Length: 207)

Name: NF12601_low_29
Description: NF12601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12601_low_29
NF12601_low_29
[»] chr3 (1 HSPs)
chr3 (16-197)||(54211840-54212021)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 54211840 - 54212021
Alignment:
16 acatcatttggagcctggccgcttaccatctactgtggatccagatgcaatacaaccacctgacaaggggaaaaaattgaaccagcgccctgtgcgaata 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54211840 acatcatttggagcctggccgcttaccatctactgtggatccagatgcaatacaaccacctgacaaggggaaaaaattgaaccagcgccctgtgcgaata 54211939  T
116 agcgcatggaaacttgcaaaattagattccaatgaagcagctaaggcattagctaaagctcgagcatcgtcgtctctgcttc 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
54211940 agcgcatggaaacttgcaaaattagattccaatgaagcagctaaggcattagctaaagctcgagcatcgtcgtctgtgcttc 54212021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University