View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12601_low_8 (Length: 318)
Name: NF12601_low_8
Description: NF12601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12601_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 16 - 306
Target Start/End: Original strand, 12405532 - 12405822
Alignment:
| Q |
16 |
gacatcatggaatcatgggaatcacttgctgctggatcatcacagcttttgaaaggaacatccatctatcttgttggtgattccactgaaatcaaccaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12405532 |
gacatcatggaatcatgggaatcacttgctgctggatcatcacagcttttgaaaggaacatccatctatcttgttggtgattccactgaaatcaaccaga |
12405631 |
T |
 |
| Q |
116 |
aagtggctgaagagcttgctactggtctggggtacgttttgtgattctaattttcactattcataatgctggtaactaggagaaataattatgcgaagtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12405632 |
aagtggctgaagagcttgctactggtctggggtacgttttgtgattctaattttcactattcataatgctggtaactaggagaaataattatgcgaagtg |
12405731 |
T |
 |
| Q |
216 |
gtgcattcttgtgttagatgtctatgattgatgcgcaactctgatcaatggcttaaattaacattctagtgttgaatgttcttctcttctc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12405732 |
gtgcattcttgtgttagatgtctatgattgatgtgcaactctgatcaatggcttaaattaacattctagtgttgaatgttcttctcttctc |
12405822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University