View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12602_low_8 (Length: 242)
Name: NF12602_low_8
Description: NF12602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12602_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 9 - 190
Target Start/End: Complemental strand, 22582698 - 22582526
Alignment:
| Q |
9 |
cttctctgctagggtttgcatgaatcacaagggaccccttcctttcatagttgattgatcaaggcttttcttacacccgactaggtcacgttgtaaccct |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22582698 |
cttctctgctagggtttgcatgaatcacaagggcttcattcctttcatagttgat----ccaggcttttcttacacccgactaggtcacgttgtaacccc |
22582603 |
T |
 |
| Q |
109 |
cgttaattataaaaccttgatttttaacaacaatagtgtannnnnnncttcttaaaacaactccaaaagtttacaacataag |
190 |
Q |
| |
|
|| ||||||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22582602 |
cg----ttataaaacatttatttttaacaacaatagtgtattctttt-ttcttaaaacaactccaaaagtttacaacataag |
22582526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 9 - 190
Target Start/End: Complemental strand, 22587529 - 22587357
Alignment:
| Q |
9 |
cttctctgctagggtttgcatgaatcacaagggaccccttcctttcatagttgattgatcaaggcttttcttacacccgactaggtcacgttgtaaccct |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22587529 |
cttctctgctagggtttgcatgaatcacaagggcttcattcctttcatagttgat----ccaggcttttcttacacccgactaggtcacgttgtaacccc |
22587434 |
T |
 |
| Q |
109 |
cgttaattataaaaccttgatttttaacaacaatagtgtannnnnnncttcttaaaacaactccaaaagtttacaacataag |
190 |
Q |
| |
|
|| ||||||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22587433 |
cg----ttataaaacatttatttttaacaacaatagtgtattctttt-ttcttaaaacaactccaaaagtttacaacataag |
22587357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University