View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12603_high_11 (Length: 239)
Name: NF12603_high_11
Description: NF12603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12603_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 6432694 - 6432475
Alignment:
| Q |
16 |
taagataaaacaaaaacatatttaaccctannnnnnnnn-cattcttattcagttgatttgaaataactccaatgtgcgcagtagttttcattctttgaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6432694 |
taagataaaacaaaaacatatttaaccctattttttttttcattcttattcagttgatttgaaataactccaatgtgcgcagtagttttcattctttgaa |
6432595 |
T |
 |
| Q |
115 |
agcaaagttggaataatgtattggctcaaacgcacactctccaaaagttccagaaatccaaatactgcaacacaacaacaacatgaacaagaacatcatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6432594 |
agcaaagttggaataatgtattggctcaaacgcacactctccaaaagttccagaaatccaaatactgcaacacaacaacaacatgaacaagaacatcatg |
6432495 |
T |
 |
| Q |
215 |
ggatcaccgatgaactcatt |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6432494 |
ggatcaccgatgaactcatt |
6432475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University