View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12603_low_10 (Length: 319)
Name: NF12603_low_10
Description: NF12603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12603_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 39300689 - 39300997
Alignment:
| Q |
1 |
gatgagacgaggctggtttttcgtgtttaaagacacgtggaagattgaaggagtgcctcgtatgagtttgtgcttggtagaaagaggtacactgcagatc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300689 |
gatgaaacgaggctggtttttcgtgtttaaagacacgtggaagattgaaggattgcctcgtatgagtttgtgcttggtagaaagaggtacactgcagatc |
39300788 |
T |
|
| Q |
101 |
aatggaagacacctggtctcaataaatgatttaacagtttattggtgattcaagaatattcaattcgatcttccttttgttgtgggttatttttgaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
39300789 |
aatggaagacacctggtctcaataaatgatttaacagtttattggtgattcaagaatattcaattcgatcttcgttttgttgtggcttatttttgaacaa |
39300888 |
T |
|
| Q |
201 |
ttatatttagactgtcattcattcaaatctcaagtttgaatctttagagtgtcaatgannnnnnnnnattttgtgtggactaatccatacataattttgt |
300 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39300889 |
ttatatttagagtgtgattcattcaaatctcaagtttgaatctttagagtgtccctga-ttttttttattttgtgtggactaatccatacataattttgt |
39300987 |
T |
|
| Q |
301 |
tttgcctttg |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
39300988 |
tttgcctttg |
39300997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University