View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12603_low_11 (Length: 262)
Name: NF12603_low_11
Description: NF12603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12603_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 25273331 - 25273138
Alignment:
| Q |
1 |
gatgctgtagctagctcctacttcttctcctatcttannnnnnnatgatttcctttctctctcaaacaaatatttcatatggcctttgtttttgttttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25273331 |
gatgctgtagctagctcctacttcttctcctatcttatttttttatgatttcctttctctctcaaacaaatatttcatatggcatttgtttttgttttga |
25273232 |
T |
|
| Q |
101 |
tgatgatgatggattgaatgctgagtgtggtggttggagagggtggcgagagagattaagagaaacttgttcttttctatgattttggctcctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25273231 |
tgatgatgatggattgaatgctgagtgtggtggttggagagggtggcgagagagattaagagaaacttgttcttttctattattttggctcctt |
25273138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University