View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12603_low_17 (Length: 229)
Name: NF12603_low_17
Description: NF12603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12603_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 3 - 212
Target Start/End: Original strand, 55574005 - 55574215
Alignment:
| Q |
3 |
tgtcatgtttttacggatgcaacatgtttgccagtattatgttacatcactaacttatgtctatatttgatcatattcatgaatctaattttccttagac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55574005 |
tgtcatgtttttacggatgcaacatgtttggcagtattatgttacatcactaacttatgtctatatttgatcatattcatgaatctaattttccttagac |
55574104 |
T |
 |
| Q |
103 |
tttagagtaaagtaggtaa-ttcaacacaagatactacacatgcatgataaattacgagcgagttaacatatcaatgagtannnnnnngtgtttgacagt |
201 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
55574105 |
tttagagttaagtaggtaatttcaacacaagatactacacatgcatgataaattacgagcgagttaacatatcaatgagtatttttttgtgtttgacagt |
55574204 |
T |
 |
| Q |
202 |
tgagattattt |
212 |
Q |
| |
|
||||||||||| |
|
|
| T |
55574205 |
tgagattattt |
55574215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University