View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12603_low_4 (Length: 455)
Name: NF12603_low_4
Description: NF12603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12603_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 19 - 152
Target Start/End: Complemental strand, 33356800 - 33356666
Alignment:
| Q |
19 |
atcaattcatcattagctgtggtgatttgtttgttttacatctcaatctcttttggttacataattgtccattgtggaatctacttgttgatgtcttttg |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33356800 |
atcaattcatcattagttgtggtgatttgtttgttttacatctcaatctcttttggttacataattgtccattgtggaatctacttgctgatgtcttttg |
33356701 |
T |
|
| Q |
119 |
gtattctcc-tttaagttgctttatggtgccttca |
152 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33356700 |
gtattctccttttaagttgctttatggtgccttca |
33356666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 216 - 349
Target Start/End: Complemental strand, 33356602 - 33356468
Alignment:
| Q |
216 |
ctatattgctaatttgtgtttttt-cctgcagaatcactgctcttaagtctaggcattcgtttgttcatccgttgaatgatgtttgattctagatgtctc |
314 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33356602 |
ctatattgctaatttgtgtttttttcctgcagaatcactgctcttaagtctaggcattcttttgttcatccgttgaaggatgtttgattctagatgtctc |
33356503 |
T |
|
| Q |
315 |
tactgatttgcaatttttcccactattcttcaaat |
349 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33356502 |
tactgatttgcaatttttctcactattcttcaaat |
33356468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University