View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12604_high_10 (Length: 241)
Name: NF12604_high_10
Description: NF12604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12604_high_10 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 188 - 241
Target Start/End: Original strand, 24923214 - 24923267
Alignment:
| Q |
188 |
gctaacaggatgtataagaaagtaatcataagtaacaagaaatctaatcctttt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
24923214 |
gctaacaggatgtataagaaagtaatcataagtaataagaaatgtaatcctttt |
24923267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 25 - 94
Target Start/End: Original strand, 24923106 - 24923172
Alignment:
| Q |
25 |
ctaccgatcaatgtttaaacacacatgtaaattcgtgtccacaacaactcacaatgaaaaaccagaagat |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||| |
|
|
| T |
24923106 |
ctaccaatcaatgtttaaacacacatgtaaattcgtgtcc---acaactcacaacgaaaaaacagaagat |
24923172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University