View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12604_high_12 (Length: 214)
Name: NF12604_high_12
Description: NF12604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12604_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 25431021 - 25431202
Alignment:
| Q |
15 |
cacagagtagttggttctttataatgtaagtgtatcccttatgctatnnnnnnnngctagaagacagcagcgagcctatgatcattgtaggttatcacaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
25431021 |
cacagagtagttggttctttataatgtaagtgtatcccttatgctataaaaaaaaattagaagacaacagcgagcctataatcattgtaggttatcacaa |
25431120 |
T |
 |
| Q |
115 |
aacttggagcatacagactactcaacctgttaacaatgaacactgggactgaaaaacaaatgaatacaatgtctctactaag |
196 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
25431121 |
aacttggagcatacagactactcaacccgttaacaatgaacactgggactggaaaaaaaatgaatacaatgtctctactaag |
25431202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University