View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12604_high_5 (Length: 303)
Name: NF12604_high_5
Description: NF12604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12604_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 7166462 - 7166737
Alignment:
| Q |
1 |
aaaaaatcaaagaagaaaagaaggatatggaaattgcagtacctctccgattcgatgctgggcgacactaaaactaaacaaccatacaacttggttgacg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7166462 |
aaaaaaacaaagaagaaaagaaggatatggaaattgcagtacctctcctattcgatgct----------aaaactaaacaaccatacaacttggttgacg |
7166551 |
T |
|
| Q |
101 |
aaacctgtggcggatggatctttccggtgagggatggccgagaactcgtcaaatattgcgacatgatatcccttgtgctttgtcatcagcgtcaacaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7166552 |
aaacctgtggcggatggatctttccggtgagggatggccgagaactcgtcaaatattgcgacatgatatcccttgtgctttgtcattagcgtcaacaaac |
7166651 |
T |
|
| Q |
201 |
cctttggcttgcacactaattgatcaatgggtgagaacgcacaactctaaactcaaac-aaaattacatagtagcatatccgagat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7166652 |
cctttggcttgcacactaattgatcaatgggtgagaacgcacaactctaaactcaaacaaaaattacatagtagcatatccgagat |
7166737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University