View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12604_low_11 (Length: 243)
Name: NF12604_low_11
Description: NF12604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12604_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 5065532 - 5065596
Alignment:
| Q |
167 |
gaaaaagtttatgtccgtacctggctctccgattctggaaccatacttcaacttgtcgtggcctt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5065532 |
gaaaaagtttatgtccgtacctggctctccgattctggaaccatacttcaacttgtcgtggcctt |
5065596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 5065282 - 5065325
Alignment:
| Q |
18 |
attgggaacacataattgtaatattatccttaaatataagcttt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5065282 |
attgggaacacataattgtaatattatccttaaatataagcttt |
5065325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University