View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12604_low_11 (Length: 243)

Name: NF12604_low_11
Description: NF12604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12604_low_11
NF12604_low_11
[»] chr5 (2 HSPs)
chr5 (167-231)||(5065532-5065596)
chr5 (18-61)||(5065282-5065325)


Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 5065532 - 5065596
Alignment:
167 gaaaaagtttatgtccgtacctggctctccgattctggaaccatacttcaacttgtcgtggcctt 231  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5065532 gaaaaagtttatgtccgtacctggctctccgattctggaaccatacttcaacttgtcgtggcctt 5065596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 5065282 - 5065325
Alignment:
18 attgggaacacataattgtaatattatccttaaatataagcttt 61  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
5065282 attgggaacacataattgtaatattatccttaaatataagcttt 5065325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University