View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12604_low_5 (Length: 342)

Name: NF12604_low_5
Description: NF12604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12604_low_5
NF12604_low_5
[»] chr8 (1 HSPs)
chr8 (10-263)||(28182303-28182556)


Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 10 - 263
Target Start/End: Original strand, 28182303 - 28182556
Alignment:
10 gcagagattacaacttgcattgaacgtttgagtttcaaaatatcttcaccggaaattgaacaacctatatccaccaccgtgacaagatccaccggcggcc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28182303 gcagagattacaacttgcattgaacgtttgagtttcaaaatatcttcaccggaaattgaacaacctatatccaccaccgtgacaagatccaccggcggcc 28182402  T
110 gatttaccaccgcattatacggctttgccttcacctttaacactgcaattaacgtctcgaagctcttgttagatgctactagagcagtttctggtagaaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28182403 gatttaccaccgcattatacggctttgccttcacctttaacactgcaattaacgtctcgaagctcttgttagatgctactagagcagtttctggtagaaa 28182502  T
210 aaacgcttcaaatgtttttgttgaagaaacatctaagccttgaaattcaacagg 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28182503 aaacgcttcaaatgtttttgttgaagaaacatctaagccttgaaattcaacagg 28182556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University