View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12604_low_5 (Length: 342)
Name: NF12604_low_5
Description: NF12604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12604_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 10 - 263
Target Start/End: Original strand, 28182303 - 28182556
Alignment:
| Q |
10 |
gcagagattacaacttgcattgaacgtttgagtttcaaaatatcttcaccggaaattgaacaacctatatccaccaccgtgacaagatccaccggcggcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182303 |
gcagagattacaacttgcattgaacgtttgagtttcaaaatatcttcaccggaaattgaacaacctatatccaccaccgtgacaagatccaccggcggcc |
28182402 |
T |
 |
| Q |
110 |
gatttaccaccgcattatacggctttgccttcacctttaacactgcaattaacgtctcgaagctcttgttagatgctactagagcagtttctggtagaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182403 |
gatttaccaccgcattatacggctttgccttcacctttaacactgcaattaacgtctcgaagctcttgttagatgctactagagcagtttctggtagaaa |
28182502 |
T |
 |
| Q |
210 |
aaacgcttcaaatgtttttgttgaagaaacatctaagccttgaaattcaacagg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182503 |
aaacgcttcaaatgtttttgttgaagaaacatctaagccttgaaattcaacagg |
28182556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University