View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12605_high_13 (Length: 221)
Name: NF12605_high_13
Description: NF12605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12605_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 14878537 - 14878351
Alignment:
| Q |
19 |
aggcggtggcaattttgtgcacgacacacaatacttgaatgataaacgtccaatgaatctaatctatattcaatgcagtggattttcttctgatccattc |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14878537 |
aggcggtggcaattttgtgtacgacacacaatacttgaatgataaacgtccaatgaatctaatctatattcaatgcactggattttcttctgatccattc |
14878438 |
T |
 |
| Q |
119 |
caaatttcacatattttcctgactcattgatatacgatcaccgctcccaaaacatgtctgctttataacttttttggcagtgttatc |
205 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14878437 |
caaatttcacatattttcgtgactctttgatatacgatcaccgctcccaaaacatgtcttctttataacttttttggcagtgttatc |
14878351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University