View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12605_low_13 (Length: 249)
Name: NF12605_low_13
Description: NF12605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12605_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 28491081 - 28490834
Alignment:
| Q |
1 |
acaacctgttagaccaccttaaaagtcgtttggaacgttgatcacaatgctgattttgagtttaccattttcataattttattattacgcaatatgtttt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28491081 |
acaacttgttagaccaccttaaaagtcgtttggaacgttgatcacaatgctgatttagaatttaccattttcataattttattattacgcaatatgtttt |
28490982 |
T |
 |
| Q |
101 |
gttatgagcttttttattgtgattttg----------tgattgttcaactgtgttatatgtatgctatttgaatgcttgttgtcattgagtatttgaatg |
190 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28490981 |
gttatgtgcttttttattgtgattttgtgatgtattgtgattgttcaactgtgttatatgtatgctatttgaatgcttgttgtcattgagtatttgaatg |
28490882 |
T |
 |
| Q |
191 |
aaaacagccttttaaacgtta-ttttatagagatgatttattgtgtct |
237 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
28490881 |
aaaacagccttttaaacgtgatttttatagagatgatttattgtgtct |
28490834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University