View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12605_low_7 (Length: 352)
Name: NF12605_low_7
Description: NF12605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12605_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 29399525 - 29399737
Alignment:
| Q |
14 |
agcagagataagaagcagtatcattatagatggccagaatcttgtggcaaaggatttgatgcttcaatggaattaaataatctcgatgttgctggtcatg |
113 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
29399525 |
agcaaagataagaagcagtatcgttatagatggccagaatcttgtggcaaaggatttgatgcttcgatggaattaaataatctcgatgttgctggccatg |
29399624 |
T |
|
| Q |
114 |
atgcataccatgcaactagcaactcaaaaataccagctactgaaagtccttgccatgttggagaagctatgagtaacttccttgattttgtctcctatat |
213 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29399625 |
attcataccatgcaactagcaactcaaaaataccagctactgaaagtccttgccatgtcggagaagctatgagtaacttccttgattttgtctcctatat |
29399724 |
T |
|
| Q |
214 |
caagactgcataa |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29399725 |
caagactgcataa |
29399737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 238 - 333
Target Start/End: Original strand, 29399708 - 29399801
Alignment:
| Q |
238 |
gattttgtattctatatcaatactgcataaataattagtttcctgttcggttgtgtgaagaagagttttttgtttacggttaaaaactattcagtg |
333 |
Q |
| |
|
|||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29399708 |
gattttgtctcctatatcaagactgcataaataattagtttcctgttcggttgtgtgaaga--gtttttttgtttacggttaaaaactattcagtg |
29399801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University