View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12605_low_8 (Length: 281)
Name: NF12605_low_8
Description: NF12605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12605_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 268
Target Start/End: Original strand, 8431779 - 8432029
Alignment:
| Q |
18 |
caagcatcacaagaagaaaaatattccaaaacccaacaaagatctcttcactccaaaggtggatactgaggtaaagagatccaagtttcagaggattttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8431779 |
caagcatcacaagaagaaaaatattccaaaacccaacaaagatctcttcactccaaaggtggatactgaggtaaagagatccaagtttcagaggattttt |
8431878 |
T |
|
| Q |
118 |
tcgcagaggtctaaagcaaaatttgcggagaggaaatcagatggttctggatttgttgatgaagggaacaacaaagcaccgcctatgggtgatatgagga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8431879 |
tcgcagaggtctaaagcaaaatttgcggaaaggaaatcagatggttctggatttgttgatgaagggaacaacaaagcaccgcctatgggtgatatgagga |
8431978 |
T |
|
| Q |
218 |
gatttgcaagtggacgtgaggctttttctaaatttgattggaaggcagtga |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8431979 |
gatttgcaagtggacgtgaggctttttctaaatttgattggaaggcagtga |
8432029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University