View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12607_high_8 (Length: 220)
Name: NF12607_high_8
Description: NF12607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12607_high_8 |
 |  |
|
| [»] scaffold0012 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0012 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 11 - 158
Target Start/End: Original strand, 164730 - 164877
Alignment:
| Q |
11 |
ctccgaaatttatgtgaaattatttgcttttacaaatttcagaaggaaatgatgatgagcacattggtacagttgttccattgaacaagaaagttggtta |
110 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
164730 |
ctccgaaatttatgtgaaattatttccttttacaaatttcagaaggaaatgatgatgagcacattggtacagttgttccattcaacaagaaagttggtta |
164829 |
T |
 |
| Q |
111 |
atctcaatcatttcggtttaattactatttatgttgttaaaatgttga |
158 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164830 |
atcttaatcatttcggtttaattactatttatgttgttaaaatgttga |
164877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 55 - 106
Target Start/End: Original strand, 163665 - 163716
Alignment:
| Q |
55 |
ggaaatgatgatgagcacattggtacagttgttccattgaacaagaaagttg |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
163665 |
ggaaatgatgacgagcacattggtacagttgttccattcaacaagaaggttg |
163716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 16 - 74
Target Start/End: Original strand, 44989891 - 44989949
Alignment:
| Q |
16 |
aaatttatgtgaaattatttgcttttacaaatttcagaaggaaatgatgatgagcacat |
74 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||| | |||||| ||||||||||| |
|
|
| T |
44989891 |
aaatttaagtgaaatgatttgcttttacaaatttcaggggtaaatgaggatgagcacat |
44989949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University