View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12607_low_5 (Length: 306)
Name: NF12607_low_5
Description: NF12607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12607_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 295
Target Start/End: Complemental strand, 32169618 - 32169342
Alignment:
| Q |
19 |
gatatgggagctagagttggtatatttgatgctgatatttacggtccaagcttaccaactatggtttctccggaaaatagaatattagaaatggtaacat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32169618 |
gatatgggagctagagttggtatatttgatgctgatatttacggtccaagcttaccaactatggtttctccggaaaatcgaatattagaaatggtaacat |
32169519 |
T |
 |
| Q |
119 |
atgataaaccattttgttttcaaatatgtaatttagtgaagtacaaaaaacacaattgtttgagtgttactgcagaatccagaaaagaagaccataattc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169518 |
atgataaaccattttgttttcaaatatgtaatttagtgaagtacaaaaaacataattgtttgagtgttactgcagaatccagaaaagaagaccataattc |
32169419 |
T |
 |
| Q |
219 |
caactgaatacatgggagtcaagttggtttcttttggatttgctggacaaggacgtgccataatgcgtggacctatg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32169418 |
caactgaatacatgggagtcaagttggtttcttttggatttgctggacaaggacgtgccataatgcgtggccctatg |
32169342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University