View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12608_high_9 (Length: 244)
Name: NF12608_high_9
Description: NF12608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12608_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 23 - 165
Target Start/End: Complemental strand, 36138648 - 36138510
Alignment:
| Q |
23 |
catttgttttgtttttgataaaattattttttctatgatattcttgattgtttaatatctcattgcacgtaannnnnnnnnnnnctctggtgtgaattgg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36138648 |
catttgttttgtttttgataaaattattttttctatgatattcttgattgtttaatatctcattgcacgtaa----ttttttttctctggtgtgaattgg |
36138553 |
T |
 |
| Q |
123 |
atatttggtgtgaaattgtgaagattaatctcctagcttaggt |
165 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36138552 |
atatttggcgtgaaattgtgaagattaatctcctagcttaggt |
36138510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University