View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1260_high_2 (Length: 335)
Name: NF1260_high_2
Description: NF1260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1260_high_2 |
 | |
|
| [»] scaffold0259 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0259 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 96 - 301
Target Start/End: Complemental strand, 19683 - 19478
Alignment:
| Q |
96 |
gaatttgtgagatttatgtgggtgattgtaatgttttatatatttcttccaaagctactttaaaatttatccagtttacatcttcataaaagagaaaaat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19683 |
gaatttgtgagatttatgtgggtgattgtaatgttttatatatttcttccaaagctactttaaaatttagccagtttacatcttcataaaagagaaaaat |
19584 |
T |
|
| Q |
196 |
ctatgtaaattgagaaacacctatcatctttacggaggtagagcaattgtggaacctaatgtataatgacaaatatgtcacagttatatcaatctctatt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19583 |
ctatgtaaattgagaaacacctatcatctttacggaggtagagcaattgtggaacctaatgtataatgacaaatatgtcacagttatatcaatctctatt |
19484 |
T |
|
| Q |
296 |
ggtaac |
301 |
Q |
| |
|
|||||| |
|
|
| T |
19483 |
ggtaac |
19478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 96 - 148
Target Start/End: Complemental strand, 14829632 - 14829580
Alignment:
| Q |
96 |
gaatttgtgagatttatgtgggtgattgtaatgttttatatatttcttccaaa |
148 |
Q |
| |
|
||||||||| ||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
14829632 |
gaatttgtgggatttatgtggctgattataatgttttaagtatttcttccaaa |
14829580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University