View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1260_low_13 (Length: 218)
Name: NF1260_low_13
Description: NF1260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1260_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 78 - 217
Target Start/End: Complemental strand, 35340181 - 35340042
Alignment:
| Q |
78 |
acaatatcagcccatagtgccgatgaaatagaaaggaggggctcctacaacacaatgagactaagctattagctcctattttcgtcaatatatccgcaca |
177 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35340181 |
acaatatcagcccatactgccgatgaaatagaaaggaggggctcctacaacacaatgagactaagctattagctcctattttcgtcaagatatccgcaca |
35340082 |
T |
 |
| Q |
178 |
aacatttcattcttggagagtatgatgatgaactatgaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35340081 |
aacatttcattcttggagagtatgatgatgaactatgaag |
35340042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 78 - 120
Target Start/End: Complemental strand, 13579401 - 13579359
Alignment:
| Q |
78 |
acaatatcagcccatagtgccgatgaaatagaaaggaggggct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13579401 |
acaatatcagcccatagtgccgatgaaatagaaaggaggggct |
13579359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University