View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1260_low_4 (Length: 353)
Name: NF1260_low_4
Description: NF1260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1260_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 100 - 276
Target Start/End: Complemental strand, 32204285 - 32204109
Alignment:
| Q |
100 |
acttattcccatttcacagcctatatgtgcgagtataatgcgattaagttcgttcacttccactaaatgaagattatttagaagccacaagtattgtgta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32204285 |
acttattcccatttcacagcctatatgtgcaagtataatgcgattaagttcgttcacttccactaaatgaagattatttagaagccacaagtattgtgta |
32204186 |
T |
|
| Q |
200 |
atattactactagggtaatacttttatgtaatggaatctatgctacaacgaatctactttgataccacttgtctgtg |
276 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32204185 |
atattactactaggataatacttttatgtaatggaatctatgctacaacgaatctactttgataccacttgtttgtg |
32204109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University