View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1260_low_8 (Length: 322)
Name: NF1260_low_8
Description: NF1260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1260_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 97 - 293
Target Start/End: Complemental strand, 22062562 - 22062366
Alignment:
| Q |
97 |
cttccaaccaaccacaaacaacactatccatttctctagctgcttttttcatctccttcacatgtcctcccaaatcaagccatccaagaaatggaattgc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22062562 |
cttccaaccaaccacaaacaacactatccatttctctagctgctttcttcatctccttcacatgtcctcccaaatcaagccatccaagaaatggaattgc |
22062463 |
T |
 |
| Q |
197 |
atcaccaaccacaaacaaacctgtcaaacgaaaaaactctctaaaaacccatctcacttttctcacttctctctcatcaccactttcacttgagtat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22062462 |
atcaccaaccacaaacaaacctgtcaaacgaaaaaactctctaaaaacccatctcacttttctcacttctctctcatcaccactttcatttgagtat |
22062366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University