View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1261-Insertion-3 (Length: 327)
Name: NF1261-Insertion-3
Description: NF1261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1261-Insertion-3 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 88 - 327
Target Start/End: Original strand, 43117687 - 43117918
Alignment:
| Q |
88 |
tttcacagaaaatggcagaagagttagttattccctcataccctttagcatcaaccgacaatattatgccaatatcagagattgttatagtttcattgcc |
187 |
Q |
| |
|
||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43117687 |
tttcacaaaaaatggcagaagagtta----ttcactcataccctttagcatcaaccgacattgttatgccaatatcagagattgttatagtttcattgtc |
43117782 |
T |
|
| Q |
188 |
atctgcatgtattctgaagtcaagcttgtggatatcatgttgtatcatatatatgttgcagagaataattgaagacctgaagcacgccctaagcaaccac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43117783 |
atctgcatgtattctgaagtcaagcttgtggatatcatgttgtatc----atatgttgcagagaataattgaagacctgaagcacgccctaagcaaccac |
43117878 |
T |
|
| Q |
288 |
cttgatgcaggaagaatttccaatttcatgaacatggtta |
327 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43117879 |
cttgatgcaggaacaatttccaatttcatgaacatggtta |
43117918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 43117591 - 43117632
Alignment:
| Q |
7 |
aagactagcataag-tccaagtttctgatgttctattagcag |
47 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43117591 |
aagactagcataaggtccaagtttctgatgttctattagcag |
43117632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University