View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12610_high_3 (Length: 420)
Name: NF12610_high_3
Description: NF12610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12610_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 18 - 407
Target Start/End: Complemental strand, 37877080 - 37876691
Alignment:
| Q |
18 |
catttttgtcgtcctcgtcggattctggatataataatgcaaatgatggtatgattgtgactgcagccggagctgaccatatgaatgagcaattggttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37877080 |
catttttgtcgtcctcgtcggattctggatataataatgcaaatgatggtatgattgtgactgctgccggagctgaccatatgaatgagcaattggttaa |
37876981 |
T |
 |
| Q |
118 |
gaagggattgttatctaggggtaaacaatcacttaaagctatttatctatctgctagaacgggtggatttccaacacaagatcatgaaagggataaattc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37876980 |
gaagggattgttatctaggggtaaacaatcacttaaagctatttatctatctgctagaacgggtggatttccaacacaagatcatgaaagggataaattt |
37876881 |
T |
 |
| Q |
218 |
gagtctgatgggtgtggtctggagatgaaatgtattcaaccgtcgttgaaagaggttcctagtgtgcctttggttgttgatcatttgccggaattatccg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37876880 |
gagtctgatgggtgtggtctggagatgaaatgtattcaaccgtctttgaaagaggttcctagtgtgcctttggttgttgatcatttgccggaattatcgg |
37876781 |
T |
 |
| Q |
318 |
aaccttcaatgttgatttcgaatagtttgaggaatgtggtttatgatgcacttccggctttaattcataggaagaaatggttaatgatgt |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37876780 |
aaccttcaatgttgatttcgaatagtttgaggaatgtggtttatgatgcacttccggctttaattcatgggaagaaatggttaatgatgt |
37876691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University