View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_high_29 (Length: 348)
Name: NF12611_high_29
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_high_29 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0019 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 334
Target Start/End: Original strand, 70990 - 71289
Alignment:
| Q |
16 |
gaaatgatgcaaagtagagctatgaaagagtaaagatttgnnnnnnngcagttgaaaaaggaattgtattttgagggtttgaagggttttggtgaagttg |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
70990 |
gaaatgatacaaagtagagctatgaaagagtaaagatttgtttttttgcagttgaaaaaggaattgtattttgagggtttgaagggttttggtgaagttg |
71089 |
T |
 |
| Q |
116 |
aggtaccatttgccatggtgaagtttgagagagtgatgaagatgggtttggtgagtgagttattatagattgaggagtttggtggtgatgattatttgtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
71090 |
aggtaccatttgccatggtgaagtttgagagagtgatgaagatgggtttggtgagtgagttattatagattgaggagtttggtgttgatgattatttgtg |
71189 |
T |
 |
| Q |
216 |
tttgaggaaatgttcgtgtgagaagaatatgtgaaaggatggtattgggtgagaattgagatgggaccggattttgggagaaagggaaatgtggggtgtt |
315 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
71190 |
tttg-------------------agaatctgtgaaaggatggtattgggtgagaattgagatgggaccggattttgggagaaagggaaatgtggggtgtt |
71270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University