View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_high_32 (Length: 288)
Name: NF12611_high_32
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 4702786 - 4702586
Alignment:
| Q |
1 |
tgaccactctccattccttttctttttgcatatggcagaatctgcctctgacatcttgctattccgctttgttgcactaaacaatgcaaataggttcagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702786 |
tgaccactctccattccttttctttttgcatatggcagaatcagcctctgacatcttgctattccgctttgttgcactaaacaatgcaaataggttcagt |
4702687 |
T |
 |
| Q |
101 |
aagtatacatactcagaagggcatcactttaataattcatagggcatcgtatgatttaacaaattattcacaacaacaaaaattagcaaagcaacaaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702686 |
aagtatacatactcagaagggcatcactttaatacttcatacggcatcttatgatttaacaaattattcacaacaacaaaaattagcaaagcaacaaacc |
4702587 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
4702586 |
t |
4702586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 227 - 288
Target Start/End: Complemental strand, 4702590 - 4702529
Alignment:
| Q |
227 |
aaccttagtatgtaaataaaagaagaaatagcaaaatcaccagagactagtggtggtatata |
288 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702590 |
aaccttagtctgtaaataaaagaagcaatagcaaaatcaccagagactagtggtggtatata |
4702529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 4706141 - 4706046
Alignment:
| Q |
19 |
tttctttttgcatatggcagaatctgcctctgacatcttgctattccgctttgttgcactaaacaatgcaaat-aggttcagtaagtatacatact |
113 |
Q |
| |
|
|||| ||||||| ||||||||||| |||| ||||||||| |||||| ||||||| ||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
4706141 |
tttcattttgcagatggcagaatcaacctccgacatcttggtattccactttgtttaactaaacaatgtaaataaggttcagtaagtatacatact |
4706046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University