View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_high_37 (Length: 266)
Name: NF12611_high_37
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 17 - 137
Target Start/End: Complemental strand, 41620201 - 41620081
Alignment:
| Q |
17 |
cagagaaaacaaaaattcccatgttataaaaacaagtagtaaaaccagtttgatttgtgaactttcatagtaaacaatataagtcagtggcattcctata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41620201 |
cagagaaaacaaaaattcccatgttataaaaacaagtagtaaaaccagtttgatttgtgaactttcatagtaaacaatataagtcagtggcattcctata |
41620102 |
T |
 |
| Q |
117 |
accttttaaaaagatggatta |
137 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41620101 |
accttttaaaaagatggatta |
41620081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 56 - 92
Target Start/End: Original strand, 42121391 - 42121427
Alignment:
| Q |
56 |
taaaaccagtttgatttgtgaactttcatagtaaaca |
92 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
42121391 |
taaaatcagtttgattggtgaactttcatagtaaaca |
42121427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University