View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_high_38 (Length: 261)
Name: NF12611_high_38
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 60 - 250
Target Start/End: Complemental strand, 15116114 - 15115926
Alignment:
| Q |
60 |
tcattggcataacaatcaggacaatccctgaccatttaattagttgtgattccgtgaattaaagacagaaaaactcatggcttaacaatgattacgccaa |
159 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
15116114 |
tcattgacataacaaccagaacaatccctgaccatttaattagttgtgattccgtgaattaaagacagaaaaactcatggcttaac---gattacaccaa |
15116018 |
T |
 |
| Q |
160 |
atctcatcaa-ttcactacaaccaaatctcaacaattaccctttccactcagcaaaactcgcaccactctcaaatcctcttattttttctgt |
250 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15116017 |
atctcatcaaattcactacaaccaaatctcaacaattaccctttccactcagcaaaactcgcaccactcccaaatcctcttattttttctgt |
15115926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 15116173 - 15116141
Alignment:
| Q |
1 |
tctcttttcttcatgttcttcatatcttcaacc |
33 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
15116173 |
tctctttttttcatgttcttcatatcttcaacc |
15116141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University