View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_26 (Length: 375)
Name: NF12611_low_26
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 170 - 361
Target Start/End: Complemental strand, 43062126 - 43061935
Alignment:
| Q |
170 |
aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaaaaggctggttacgctctgtgat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062126 |
aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaaaaggctggttacgctctgtgat |
43062027 |
T |
|
| Q |
270 |
caagctccaccaacttcttatcacactgttaaacttgtgcttgagaatgagcttggaatgagtattgatgatgtgtttgatagatttgatgt |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43062026 |
caagctccaccaacttcttatcacactgttaaacttgtgcttgagaatgagcttggaatgagtattcatgatgtgtttgatagatttgatgt |
43061935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 9 - 105
Target Start/End: Complemental strand, 43062287 - 43062191
Alignment:
| Q |
9 |
gcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgccgataagattttctctatgtgctctgaccttggtggtttcttcctcaagg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062287 |
gcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgccgataagattttctctatgtgctctgaccttggtggtttcttcctcaagg |
43062191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University