View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_47 (Length: 269)
Name: NF12611_low_47
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 252
Target Start/End: Complemental strand, 4263997 - 4263760
Alignment:
| Q |
16 |
ctgtttcttctatattaatattgcnnnnnnnn-aatatatatgatttcaatgtgattttgaggttcaatttccacttacccggaagttatttttcaattg |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4263997 |
ctgtttcttctatattaatattgcttatttttgaatatatatgatttcaatgtgattttgaggttcaatttccacttacccggaagttatttttcaattg |
4263898 |
T |
|
| Q |
115 |
attgattattgagttagttgttactacctttggtaggaattagttagtagttgactatgatgcacagacactcctagaatcctcatattaggcgtgtcct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4263897 |
attgattattgagttagttgttactacctttggtaggaattagttagtagttgactatgatgcacggacactcctagaatcctcagattaggcgtgtcct |
4263798 |
T |
|
| Q |
215 |
gttgtcaggcacgttatgattccattgaattatgtgat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4263797 |
gttgtcaggcacgttatgattccattgaattatgtgat |
4263760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University