View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_48 (Length: 269)
Name: NF12611_low_48
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_48 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 32748976 - 32749244
Alignment:
| Q |
1 |
gcagcatagttatctaaataatctgcattgttgtgtgcagcaagcctgctttcatcttttaatggcaaataatcaccaacatatccacttgtataatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32748976 |
gcagcatagttatctaaataatctgcattgttgtgtgcagcaagcctgctttcatcttttaatggcaaataatcaccaacatatccacttgtataatcca |
32749075 |
T |
|
| Q |
101 |
ctccaagctcagaagaccttctctgtttgcttactaaaatatcatctgcactgaatccattgtaccgtgcagaataatctccttggtaattatgcattaa |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32749076 |
ctccaagctcagaagaccttctttgtttgcttactaaaatatcatctgcactgaatccattgtaccgtgcagaataatctccttggtaattatgcattaa |
32749175 |
T |
|
| Q |
201 |
gacaggtgaacttttatcacccaaaactctgtcattttgaacattttcatcaagcattccatgaccaaa |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32749176 |
gacaggtgaacttttatcacccaaaactctgtcattttgaacattttcatcaagcattccatgaccaaa |
32749244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University