View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_52 (Length: 260)
Name: NF12611_low_52
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 1447433 - 1447679
Alignment:
| Q |
1 |
atcatggacacactcggggcccttgccctggctacggaaccaccaacagaccacctaatgcacagatcaccagttggtcgaaggtttggattgacttgct |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1447433 |
atcatggacacacttggggcccttgccctggctacggaaccaccaacagaccacctaatgcacagatcaccagttggtcgaaggtttggattgacttgct |
1447532 |
T |
|
| Q |
101 |
ttctcatttgtcacttcattagctattaatttacagtaacactcttaattcttaaagctgggctggcacgtatatgcacactcatgtacacatggcttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1447533 |
ttctcatttgtcacttcattagctattaatttacagtaacactcttaattcttaaagctgggctggcacgtatatgcacactcatgtacacatggcttat |
1447632 |
T |
|
| Q |
201 |
attttatgtgttttcagttttgatccttggtgtgtgtgtatgtgtct |
247 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1447633 |
atttgatgtgttttcagttttgatccttggtgtgtgtgtgtgtgtct |
1447679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 4 - 94
Target Start/End: Complemental strand, 45565836 - 45565746
Alignment:
| Q |
4 |
atggacacactcggggcccttgccctggctacggaaccaccaacagaccacctaatgcacagatcaccagttggtcgaaggtttggattga |
94 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| ||||||||||| ||| ||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45565836 |
atggacacacttggggctcttgctctggctactgaaccaccaactgacagccttatgcacagatcaccagttggccgaaggtttggattga |
45565746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University