View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_56 (Length: 251)
Name: NF12611_low_56
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 41182962 - 41182721
Alignment:
| Q |
1 |
tccatgtatgacaacagcatggaaactgttttagtgtcacaactgttgtggttatagtggcggaaatcacgtcgtgtagtgtgcttttgggccacggtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
41182962 |
tccatgtatgacaacagcatggaaactgttttagtgtcacaactgttgtggttatagtggcggaaatcatggcgtgtagtgtgcttttgggccacggtga |
41182863 |
T |
|
| Q |
101 |
tggaactatcttataaacccaaaatatccatgatattttaattttacataggtgggtttgggagt-ttttaatgtttttggaatttaaaaatagaaaacc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
41182862 |
tggaactatcttataaacccaaaatatccatgatattttaattttacataggtgggtttgggagtattttaatgtttttggaatttaaaaatagaaaagc |
41182763 |
T |
|
| Q |
200 |
cttgtctgtttttcatttccaaatagcagcctcccctctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41182762 |
cttgtctgtttttcatttccaaatagcagcctcccctctctg |
41182721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University