View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_65 (Length: 242)
Name: NF12611_low_65
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_65 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 4 - 242
Target Start/End: Complemental strand, 41183292 - 41183058
Alignment:
| Q |
4 |
tcactgacatcacctgcgtggtgaagcacggaaaaatcagacaagttgcaaagagggaaacaaaaggtatgtcctaatttnnnnnnnnnnnnnnnnnnnt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41183292 |
tcactgacatcacctgcgtggtgaagcacggaaaaatcagacaagttgcaaagagggaaacaaaaggtatgtcctaatttcaaaaaaaaacaaaa----t |
41183197 |
T |
 |
| Q |
104 |
gaagagaacgggaatgaactgatttattataatatcaacttgtagaaacattattgctttgagcaaagataaatcagccccttgaagagaaatagaaata |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41183196 |
gaagagaacgggaatgaactgatttattataatatcaacttgtagaaacattattgctttgagcaaagataaatcagccccttgaagagaaatagaaata |
41183097 |
T |
 |
| Q |
204 |
tagcaggatgaaactgtgggtcttgataatgacattggc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41183096 |
tagcaggatgaaactgtgggtcttgataatgacattggc |
41183058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University