View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_67 (Length: 235)
Name: NF12611_low_67
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 11903666 - 11903880
Alignment:
| Q |
1 |
gttgagccactagtagtactctcgttgtaacggagaacctccatcgagtcatttaaatcgatgaccacgtctctaaccttttgcagcaaaggaagaagac |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11903666 |
gttgagccactagtagtactttcgttgtaacggagaacctccatcaagtcatttaaatcgatgaccacgtctctaaccttttgcagcaaaggaagaagac |
11903765 |
T |
 |
| Q |
101 |
gtccttcacctatggaggagtagctcagtttctggactttgtcattgatttctttgagaatattttcaagattgttgatgtgatctattcctgataaacg |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11903766 |
gtacttcacctatggaggagtagctcagtttctggactttgtcattgatttctttgagaatatcttcaagcttgttgatgtgatctattcctgataaacg |
11903865 |
T |
 |
| Q |
201 |
agtaggtataggttt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11903866 |
agtaggtataggttt |
11903880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University