View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_68 (Length: 232)
Name: NF12611_low_68
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 9031770 - 9031971
Alignment:
| Q |
20 |
agatcggggtgcaatcatcacttgaacaaattaagctagtgtaattaatgatataattacacactctcttcatataccccacaggatcagtggaaataaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9031770 |
agatcggggtgcaatcatcacttgaacaaattaagctagtgtaattaatgatataattacacactctcttcatataccccacaggatcagtgaaaataaa |
9031869 |
T |
 |
| Q |
120 |
tagcattttacttgattaatttacaaaaataatgtatgaataagtttgttctgacttgcatgttatgttggtcatccatatatcttgtacattgatgtcc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9031870 |
tagcattttacttgattaatttacaaaaaaaatgtatgaataagtttgttctgacttgcatgttatgttggtcatccatatatcttgtacattgatatcc |
9031969 |
T |
 |
| Q |
220 |
at |
221 |
Q |
| |
|
|| |
|
|
| T |
9031970 |
at |
9031971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University